Transcript: Mouse NM_024450.2

Mus musculus stearoyl-coenzyme A desaturase 3 (Scd3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Scd3 (30049)
Length:
3470
CDS:
234..1313

Additional Resources:

NCBI RefSeq record:
NM_024450.2
NBCI Gene record:
Scd3 (30049)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_024450.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114342 CCCTACGATAAGAACATCGAT pLKO.1 1056 CDS 100% 3.000 4.200 N Scd3 n/a
2 TRCN0000114345 GCCACTTTACTGAGATACGCT pLKO.1 978 CDS 100% 0.750 0.600 N Scd3 n/a
3 TRCN0000114344 CCTGGTTTCCTTGGGAAGTAT pLKO.1 1091 CDS 100% 5.625 3.938 N Scd3 n/a
4 TRCN0000114341 GCAGAAATTCTCCTGTTCTTA pLKO.1 1477 3UTR 100% 5.625 3.938 N Scd3 n/a
5 TRCN0000114343 CGCGTTTGTCTACTATGTGAT pLKO.1 542 CDS 100% 4.950 3.465 N Scd3 n/a
6 TRCN0000441270 TGCGGATCTTCCTCATCATTG pLKO_005 634 CDS 100% 10.800 6.480 N Scd3 n/a
7 TRCN0000438471 ACGTCTGGAGGAACATCATTC pLKO_005 445 CDS 100% 10.800 5.400 Y Scd3 n/a
8 TRCN0000437149 CGTTCCAGAATGACGTGTATG pLKO_005 667 CDS 100% 10.800 5.400 Y Scd3 n/a
9 TRCN0000177680 CCATCTGTAATGGGATCTGAT pLKO.1 2042 3UTR 100% 4.950 2.475 Y Etfrf1 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1751 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024450.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.