Transcript: Human NM_024577.4

Homo sapiens SH3 domain and tetratricopeptide repeats 2 (SH3TC2), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
SH3TC2 (79628)
Length:
26468
CDS:
41..3907

Additional Resources:

NCBI RefSeq record:
NM_024577.4
NBCI Gene record:
SH3TC2 (79628)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024577.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434202 TGCAGGCTGTACGACTCTATT pLKO_005 2739 CDS 100% 13.200 10.560 N SH3TC2 n/a
2 TRCN0000008575 CGACATCTAAAGAGTCAGCTT pLKO.1 2900 CDS 100% 2.640 2.112 N SH3TC2 n/a
3 TRCN0000430107 AGTTCTCCACCTACCTTAATT pLKO_005 402 CDS 100% 15.000 10.500 N SH3TC2 n/a
4 TRCN0000436549 GTACTATGCCAAGGTGTATTA pLKO_005 3661 CDS 100% 13.200 9.240 N SH3TC2 n/a
5 TRCN0000008572 GCAGCTTTATCGGAACCTAAA pLKO.1 3064 CDS 100% 10.800 7.560 N SH3TC2 n/a
6 TRCN0000424149 TGAGCATCAGGAAGGTCAAAC pLKO_005 1650 CDS 100% 10.800 7.560 N SH3TC2 n/a
7 TRCN0000008573 GCAGGTGATGTGTTCTTCAAT pLKO.1 3308 CDS 100% 5.625 3.938 N SH3TC2 n/a
8 TRCN0000008574 CCTCATCTGAATACAAGGAAA pLKO.1 141 CDS 100% 4.950 3.465 N SH3TC2 n/a
9 TRCN0000008571 GCCCAGGTAAAGAAACTCCTT pLKO.1 87 CDS 100% 2.640 1.848 N SH3TC2 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 20763 3UTR 100% 4.950 2.475 Y KAAG1 n/a
11 TRCN0000015008 CCAACCAACCAACCAACCAAA pLKO.1 13959 3UTR 100% 4.950 2.475 Y HMBOX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024577.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.