Transcript: Human NM_024641.4

Homo sapiens mannosidase endo-alpha (MANEA), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MANEA (79694)
Length:
4578
CDS:
143..1531

Additional Resources:

NCBI RefSeq record:
NM_024641.4
NBCI Gene record:
MANEA (79694)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024641.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049649 CCCTAGAATAGCCAAGAATTA pLKO.1 538 CDS 100% 13.200 18.480 N MANEA n/a
2 TRCN0000333836 CCCTAGAATAGCCAAGAATTA pLKO_005 538 CDS 100% 13.200 18.480 N MANEA n/a
3 TRCN0000049652 CCGAATCAATGGGAAGTATTA pLKO.1 1267 CDS 100% 13.200 10.560 N MANEA n/a
4 TRCN0000333837 CCGAATCAATGGGAAGTATTA pLKO_005 1267 CDS 100% 13.200 10.560 N MANEA n/a
5 TRCN0000049648 CCCATTATAGACATGGTGAAT pLKO.1 3572 3UTR 100% 4.950 3.465 N MANEA n/a
6 TRCN0000333838 CCCATTATAGACATGGTGAAT pLKO_005 3572 3UTR 100% 4.950 3.465 N MANEA n/a
7 TRCN0000049650 CGTCCTCATAAACCAGGTCTT pLKO.1 1424 CDS 100% 4.050 2.835 N MANEA n/a
8 TRCN0000049651 GCCTCTGAACTTAACTTGGAT pLKO.1 404 CDS 100% 3.000 2.100 N MANEA n/a
9 TRCN0000333835 GCCTCTGAACTTAACTTGGAT pLKO_005 404 CDS 100% 3.000 2.100 N MANEA n/a
10 TRCN0000179691 GCCCAGGATACATAGATACAA pLKO.1 1212 CDS 100% 5.625 3.938 N Manea n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024641.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.