Transcript: Human NM_024644.5

Homo sapiens ribosomal oxygenase 1 (RIOX1), mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
RIOX1 (79697)
Length:
2462
CDS:
86..2011

Additional Resources:

NCBI RefSeq record:
NM_024644.5
NBCI Gene record:
RIOX1 (79697)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024644.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375742 CCGAGACTTCATGGATTACAT pLKO_005 1450 CDS 100% 5.625 7.875 N Riox1 n/a
2 TRCN0000422340 GATGCCTCTAGCCCTAAATTA pLKO_005 1990 CDS 100% 15.000 10.500 N RIOX1 n/a
3 TRCN0000436358 TAGGAAACTCTGGCGTGTATA pLKO_005 1144 CDS 100% 13.200 9.240 N RIOX1 n/a
4 TRCN0000173069 CCCGAGACTTCATGGATTACA pLKO.1 1449 CDS 100% 5.625 3.938 N RIOX1 n/a
5 TRCN0000168757 GAACCTGGAGATTTGCTGTAT pLKO.1 1259 CDS 100% 4.950 3.465 N RIOX1 n/a
6 TRCN0000172707 GCCCAGTTGACAACAGAAACA pLKO.1 1703 CDS 100% 4.950 3.465 N RIOX1 n/a
7 TRCN0000172344 CCGTGTGTATCATCTGGAAGA pLKO.1 1807 CDS 100% 4.050 2.835 N RIOX1 n/a
8 TRCN0000180487 GCTTCATTCACCAAGCTGAAT pLKO.1 1290 CDS 100% 0.495 0.347 N Riox1 n/a
9 TRCN0000173096 CCATATGCTTCAGGATGGGAT pLKO.1 1729 CDS 100% 0.000 0.000 N RIOX1 n/a
10 TRCN0000436145 ACCCTTGATCCGTGATCATTT pLKO_005 2235 3UTR 100% 13.200 6.600 Y RIOX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024644.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.