Transcript: Human NM_024656.4

Homo sapiens collagen beta(1-O)galactosyltransferase 1 (COLGALT1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
COLGALT1 (79709)
Length:
3647
CDS:
66..1934

Additional Resources:

NCBI RefSeq record:
NM_024656.4
NBCI Gene record:
COLGALT1 (79709)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024656.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034888 CAGGCAGAGGTTCAGATGTAT pLKO.1 888 CDS 100% 5.625 7.875 N COLGALT1 n/a
2 TRCN0000034884 GCCGTGAAGAGTTTGTACCAT pLKO.1 384 CDS 100% 3.000 4.200 N COLGALT1 n/a
3 TRCN0000289433 GCCGTGAAGAGTTTGTACCAT pLKO_005 384 CDS 100% 3.000 4.200 N COLGALT1 n/a
4 TRCN0000034887 CGTATGGAACAATGAGCACGT pLKO.1 1790 CDS 100% 2.160 1.728 N COLGALT1 n/a
5 TRCN0000289434 CGTATGGAACAATGAGCACGT pLKO_005 1790 CDS 100% 2.160 1.728 N COLGALT1 n/a
6 TRCN0000034885 CCTGTTTGTAGATGCGGACAA pLKO.1 551 CDS 100% 4.050 2.835 N COLGALT1 n/a
7 TRCN0000289371 CCTGTTTGTAGATGCGGACAA pLKO_005 551 CDS 100% 4.050 2.835 N COLGALT1 n/a
8 TRCN0000034886 GCCTACGTGATCTCCCTGCAA pLKO.1 1557 CDS 100% 0.880 0.616 N COLGALT1 n/a
9 TRCN0000289372 GCCTACGTGATCTCCCTGCAA pLKO_005 1557 CDS 100% 0.880 0.616 N COLGALT1 n/a
10 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2619 3UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024656.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.