Transcript: Human NM_024787.3

Homo sapiens ring finger protein 122 (RNF122), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
RNF122 (79845)
Length:
1872
CDS:
406..873

Additional Resources:

NCBI RefSeq record:
NM_024787.3
NBCI Gene record:
RNF122 (79845)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024787.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022432 CCTTCCGCTCAACATCTATAT pLKO.1 501 CDS 100% 13.200 18.480 N RNF122 n/a
2 TRCN0000022433 GCCCATTGCTAGTCCCTCAGA pLKO.1 810 CDS 100% 0.880 0.704 N RNF122 n/a
3 TRCN0000022430 CCTTATCTTCTGCTGCTATTT pLKO.1 561 CDS 100% 13.200 9.240 N RNF122 n/a
4 TRCN0000022431 GATGCCAAGAAGTTACAATTA pLKO.1 649 CDS 100% 13.200 9.240 N RNF122 n/a
5 TRCN0000022429 CGGGCTCTTACCTCTCTACAA pLKO.1 1257 3UTR 100% 4.950 3.465 N RNF122 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024787.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.