Transcript: Human NM_024855.4

Homo sapiens actin related protein 5 (ACTR5), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ACTR5 (79913)
Length:
2547
CDS:
20..1843

Additional Resources:

NCBI RefSeq record:
NM_024855.4
NBCI Gene record:
ACTR5 (79913)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024855.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437864 CGTCTGGACCGACTGCTATAT pLKO_005 986 CDS 100% 13.200 18.480 N ACTR5 n/a
2 TRCN0000413393 GCTACATCGCTGAGGATTATG pLKO_005 768 CDS 100% 13.200 18.480 N ACTR5 n/a
3 TRCN0000419780 CGATGTATCCTGGCATGAAAG pLKO_005 1512 CDS 100% 10.800 15.120 N ACTR5 n/a
4 TRCN0000425828 GACTGATTTCTTACCACATTT pLKO_005 2160 3UTR 100% 13.200 9.240 N ACTR5 n/a
5 TRCN0000418705 CACAAGATGCAGCTCCCATTT pLKO_005 839 CDS 100% 10.800 7.560 N ACTR5 n/a
6 TRCN0000116703 CCCACTGTATTCACGGCAAAT pLKO.1 439 CDS 100% 10.800 7.560 N ACTR5 n/a
7 TRCN0000116705 GCATATCATCAGCTATTTGTT pLKO.1 1331 CDS 100% 5.625 3.938 N ACTR5 n/a
8 TRCN0000116702 CCTTCTGATGTCTTTGTTCAA pLKO.1 2060 3UTR 100% 4.950 3.465 N ACTR5 n/a
9 TRCN0000116704 GCCTTGAACCACCTAGATGAT pLKO.1 1640 CDS 100% 4.950 3.465 N ACTR5 n/a
10 TRCN0000089556 CGCATCAATCTTGGAGGAAGT pLKO.1 647 CDS 100% 4.050 2.835 N Actr5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024855.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.