Transcript: Human NM_025004.3

Homo sapiens coiled-coil domain containing 15 (CCDC15), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CCDC15 (80071)
Length:
3812
CDS:
179..3034

Additional Resources:

NCBI RefSeq record:
NM_025004.3
NBCI Gene record:
CCDC15 (80071)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025004.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146592 CCTCTGGACTATCATCAATAT pLKO.1 2255 CDS 100% 13.200 18.480 N CCDC15 n/a
2 TRCN0000420232 GGCTTATGATAGGTATCAATC pLKO_005 2392 CDS 100% 10.800 15.120 N CCDC15 n/a
3 TRCN0000416142 ACAAGTTAAATACCGAGTAAA pLKO_005 433 CDS 100% 13.200 10.560 N CCDC15 n/a
4 TRCN0000421731 AGAGGAGAGTTGCCCATTAAG pLKO_005 857 CDS 100% 13.200 9.240 N CCDC15 n/a
5 TRCN0000434888 ATTGAGAGAGAACAAGTTAAA pLKO_005 2528 CDS 100% 13.200 9.240 N CCDC15 n/a
6 TRCN0000434145 TTTCAGTCTGACGTGGATAAA pLKO_005 2447 CDS 100% 13.200 9.240 N CCDC15 n/a
7 TRCN0000130982 CCCAGAGACCAAGGTTATCTT pLKO.1 1937 CDS 100% 5.625 3.938 N CCDC15 n/a
8 TRCN0000129272 CCCAGGCTCTTAGTGAAACTA pLKO.1 687 CDS 100% 5.625 3.938 N CCDC15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025004.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.