Transcript: Human NM_025054.5

Homo sapiens valosin containing protein interacting protein 1 (VCPIP1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
VCPIP1 (80124)
Length:
9956
CDS:
274..3942

Additional Resources:

NCBI RefSeq record:
NM_025054.5
NBCI Gene record:
VCPIP1 (80124)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025054.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236140 GAAAGTTGTCCACACTATATT pLKO_005 2208 CDS 100% 15.000 21.000 N VCPIP1 n/a
2 TRCN0000073822 GCTCCGGTAGAAACCATTATA pLKO.1 1319 CDS 100% 15.000 21.000 N VCPIP1 n/a
3 TRCN0000236141 GTGCTACATCGTCCTATTATT pLKO_005 1165 CDS 100% 15.000 21.000 N VCPIP1 n/a
4 TRCN0000073820 CGTCCTATTATTCTGTTAGAT pLKO.1 1174 CDS 100% 5.625 7.875 N VCPIP1 n/a
5 TRCN0000073818 CCTCACTAATAACTAACCTTT pLKO.1 7104 3UTR 100% 4.950 6.930 N VCPIP1 n/a
6 TRCN0000073819 CGATGATTATACTCCTGTAAA pLKO.1 2253 CDS 100% 13.200 10.560 N VCPIP1 n/a
7 TRCN0000073821 CCGATGATTATACTCCTGTAA pLKO.1 2252 CDS 100% 4.950 3.960 N VCPIP1 n/a
8 TRCN0000236142 CTCCGGTAGAAACCATTATAT pLKO_005 1320 CDS 100% 15.000 10.500 N VCPIP1 n/a
9 TRCN0000236143 CTCGTCCTGAGCCCTTATTAT pLKO_005 7958 3UTR 100% 15.000 10.500 N VCPIP1 n/a
10 TRCN0000236144 GTGTGCCTCAGGACCTTATTA pLKO_005 1409 CDS 100% 15.000 10.500 N VCPIP1 n/a
11 TRCN0000030975 CCTCCATATTTACAGTGTATT pLKO.1 2704 CDS 100% 13.200 9.240 N Vcpip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025054.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.