Transcript: Mouse NM_025286.3

Mus musculus solute carrier family 31, member 2 (Slc31a2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Slc31a2 (20530)
Length:
1841
CDS:
141..572

Additional Resources:

NCBI RefSeq record:
NM_025286.3
NBCI Gene record:
Slc31a2 (20530)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025286.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068500 CATGTCATTCAGGTGGTAATT pLKO.1 438 CDS 100% 13.200 18.480 N Slc31a2 n/a
2 TRCN0000068499 CCCACTTCTCAACATGACTTA pLKO.1 551 CDS 100% 4.950 3.960 N Slc31a2 n/a
3 TRCN0000303006 CCCACTTCTCAACATGACTTA pLKO_005 551 CDS 100% 4.950 3.960 N Slc31a2 n/a
4 TRCN0000311235 GGACCAGACCAGGATTCTACA pLKO_005 345 CDS 100% 4.950 3.960 N Slc31a2 n/a
5 TRCN0000305033 GATCTCTGACTGCAAATTAAA pLKO_005 864 3UTR 100% 15.000 10.500 N Slc31a2 n/a
6 TRCN0000311233 CAAGGTTGGCAAAGCCAAATT pLKO_005 269 CDS 100% 13.200 9.240 N Slc31a2 n/a
7 TRCN0000068501 CCAGATCAACTTCAGACAATA pLKO.1 370 CDS 100% 13.200 9.240 N Slc31a2 n/a
8 TRCN0000068502 AGGCCGTGCTTCTCTTTGATT pLKO.1 169 CDS 100% 5.625 3.938 N Slc31a2 n/a
9 TRCN0000068498 GCCTTGGAACACATGAGGATT pLKO.1 1014 3UTR 100% 4.950 3.465 N Slc31a2 n/a
10 TRCN0000311234 CTTGCTCCTGGCAGTACTGTA pLKO_005 239 CDS 100% 4.950 2.970 N Slc31a2 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1692 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025286.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.