Transcript: Mouse NM_025287.2

Mus musculus speckle-type POZ protein (Spop), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Spop (20747)
Length:
2882
CDS:
189..1313

Additional Resources:

NCBI RefSeq record:
NM_025287.2
NBCI Gene record:
Spop (20747)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124640 CCTGTCGCTTTACCTGTTGTT pLKO.1 437 CDS 100% 4.950 6.930 N Spop n/a
2 TRCN0000124643 GTAAACCCGAAAGGGCTAGAT pLKO.1 399 CDS 100% 4.950 6.930 N Spop n/a
3 TRCN0000124641 CGAGCTTATAGGTTCGTGCAA pLKO.1 549 CDS 100% 2.640 3.696 N Spop n/a
4 TRCN0000139400 CAAAGAGTGAAGTTCGGGCAA pLKO.1 469 CDS 100% 2.160 3.024 N SPOP n/a
5 TRCN0000374906 GTACAAGACTCTGTCAATATT pLKO_005 678 CDS 100% 15.000 12.000 N Spop n/a
6 TRCN0000374905 ACGTGGAGCCTGAGGTGTTTA pLKO_005 922 CDS 100% 13.200 9.240 N Spop n/a
7 TRCN0000366282 GAAATGGTGTTTGCGAGTAAA pLKO_005 383 CDS 100% 13.200 9.240 N Spop n/a
8 TRCN0000124639 GCAGTGGTACTTCGGAGAAAT pLKO.1 1614 3UTR 100% 13.200 9.240 N Spop n/a
9 TRCN0000376699 GGAGAGTCAGCGAGCTTATAG pLKO_005 539 CDS 100% 13.200 9.240 N Spop n/a
10 TRCN0000374850 TGTGGACCATCAATAACTTTA pLKO_005 292 CDS 100% 13.200 9.240 N Spop n/a
11 TRCN0000366281 TTCATCAGGAGCCAATGATAA pLKO_005 359 CDS 100% 13.200 9.240 N Spop n/a
12 TRCN0000139811 CAAACGCCTGAAGCAATCCTA pLKO.1 1292 CDS 100% 3.000 2.100 N SPOP n/a
13 TRCN0000139181 CACAAGGCTATCTTAGCAGCT pLKO.1 828 CDS 100% 2.160 1.512 N SPOP n/a
14 TRCN0000343155 CACAAGGCTATCTTAGCAGCT pLKO_005 828 CDS 100% 2.160 1.512 N SPOP n/a
15 TRCN0000139043 CTCCTACATGTGGACCATCAA pLKO.1 284 CDS 100% 4.950 2.970 N SPOP n/a
16 TRCN0000343090 CTCCTACATGTGGACCATCAA pLKO_005 284 CDS 100% 4.950 2.970 N SPOP n/a
17 TRCN0000144406 CACAGATCAAGGTAGTGAAAT pLKO.1 262 CDS 100% 13.200 9.240 N SPOP n/a
18 TRCN0000343089 CACAGATCAAGGTAGTGAAAT pLKO_005 262 CDS 100% 13.200 9.240 N SPOP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.