Transcript: Mouse NM_025288.2

Mus musculus stefin A3 (Stfa3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Stfa3 (20863)
Length:
412
CDS:
29..340

Additional Resources:

NCBI RefSeq record:
NM_025288.2
NBCI Gene record:
Stfa3 (20863)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025288.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079998 TCGAGGCTGTCGAGTATAAAT pLKO.1 159 CDS 100% 15.000 21.000 N Stfa3 n/a
2 TRCN0000080002 AGATGTAGGGAATGGTTGTTT pLKO.1 217 CDS 100% 5.625 3.938 N Stfa3 n/a
3 TRCN0000080000 GCCTTTCTGGAGAAGATGATT pLKO.1 261 CDS 100% 5.625 3.938 N Stfa3 n/a
4 TRCN0000079999 GTAGGGAATGGTTGTTTCCTT pLKO.1 221 CDS 100% 3.000 2.100 N Stfa3 n/a
5 TRCN0000253362 CACCAGAAATCCAGATGATTG pLKO_005 84 CDS 100% 10.800 5.400 Y Stfa1 n/a
6 TRCN0000080001 CACACCAGAAATCCAGATGAT pLKO.1 82 CDS 100% 4.950 2.475 Y Stfa3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025288.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.