Transcript: Mouse NM_025296.4

Mus musculus cytosolic iron-sulfur protein assembly 1 (Ciao1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ciao1 (26371)
Length:
3075
CDS:
197..1216

Additional Resources:

NCBI RefSeq record:
NM_025296.4
NBCI Gene record:
Ciao1 (26371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025296.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304536 TCTCATACGCAGGACGTTAAG pLKO_005 638 CDS 100% 10.800 15.120 N Ciao1 n/a
2 TRCN0000086230 CGCCAGTATCTACCGGGCAAT pLKO.1 860 CDS 100% 1.350 1.890 N Ciao1 n/a
3 TRCN0000086231 GTGAAGCTATACCAGGAAGAA pLKO.1 716 CDS 100% 4.950 3.960 N Ciao1 n/a
4 TRCN0000302004 GTGAAGCTATACCAGGAAGAA pLKO_005 716 CDS 100% 4.950 3.960 N Ciao1 n/a
5 TRCN0000086232 ACAGTGAAGCTATACCAGGAA pLKO.1 713 CDS 100% 2.640 2.112 N Ciao1 n/a
6 TRCN0000311014 TTTGATGCCACCACTTGTATT pLKO_005 437 CDS 100% 13.200 9.240 N Ciao1 n/a
7 TRCN0000418262 AGAAGAACCAGGATGACTTTG pLKO_005 462 CDS 100% 10.800 7.560 N CIAO1 n/a
8 TRCN0000086228 CGGGCTATACTTTGCTGCATA pLKO.1 1655 3UTR 100% 4.950 3.465 N Ciao1 n/a
9 TRCN0000086229 GCTGGAAATGTATCTGCACTT pLKO.1 915 CDS 100% 4.050 2.835 N Ciao1 n/a
10 TRCN0000302067 GCTGGAAATGTATCTGCACTT pLKO_005 915 CDS 100% 4.050 2.835 N Ciao1 n/a
11 TRCN0000304535 TTAGGGCATGGTGTTACATTT pLKO_005 1401 3UTR 100% 13.200 7.920 N Ciao1 n/a
12 TRCN0000436443 AGCATCCTTGACCTTCATTTA pLKO_005 1290 3UTR 100% 13.200 9.240 N CIAO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025296.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.