Transcript: Mouse NM_025359.3

Mus musculus tetraspanin 13 (Tspan13), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tspan13 (66109)
Length:
1923
CDS:
166..780

Additional Resources:

NCBI RefSeq record:
NM_025359.3
NBCI Gene record:
Tspan13 (66109)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025359.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381600 ATACTGCAAGTGCTCGAAATG pLKO_005 506 CDS 100% 10.800 15.120 N Tspan13 n/a
2 TRCN0000379922 TTCCGGAGCTATAACCCAAAT pLKO_005 556 CDS 100% 10.800 8.640 N Tspan13 n/a
3 TRCN0000120862 CCGTGGCCTTTCTTAGCATTT pLKO.1 1041 3UTR 100% 10.800 7.560 N Tspan13 n/a
4 TRCN0000381588 GTGCTTGTTTAGCTCTGAATC pLKO_005 446 CDS 100% 10.800 7.560 N Tspan13 n/a
5 TRCN0000380491 GCATTGGTCTCTTCTTCAGTT pLKO_005 677 CDS 100% 4.950 3.465 N Tspan13 n/a
6 TRCN0000380743 TGCTTTCCTTTGACGAGAAGA pLKO_005 768 CDS 100% 4.950 3.465 N Tspan13 n/a
7 TRCN0000381652 AGCCTGCTGCTCATTGGGATT pLKO_005 235 CDS 100% 4.050 2.430 N Tspan13 n/a
8 TRCN0000120866 CCTACTTGTATTTATTGTCCA pLKO.1 411 CDS 100% 2.640 1.584 N Tspan13 n/a
9 TRCN0000381446 AGATCCTGGGTGTTTGGCTGA pLKO_005 704 CDS 100% 2.160 1.296 N Tspan13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025359.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.