Transcript: Mouse NM_025390.4

Mus musculus processing of precursor 4, ribonuclease P/MRP family, (S. cerevisiae) (Pop4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Pop4 (66161)
Length:
1214
CDS:
196..861

Additional Resources:

NCBI RefSeq record:
NM_025390.4
NBCI Gene record:
Pop4 (66161)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025390.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307424 ATGCGGCTCTTTGACATTAAA pLKO_005 448 CDS 100% 15.000 21.000 N Pop4 n/a
2 TRCN0000307423 GGCCGTGATCTTGGAATATTT pLKO_005 357 CDS 100% 15.000 12.000 N Pop4 n/a
3 TRCN0000098856 CCTACATTTATGGAAGCAAAT pLKO.1 776 CDS 100% 10.800 7.560 N Pop4 n/a
4 TRCN0000098857 CCATGAACTCTGGAAACAGTA pLKO.1 504 CDS 100% 4.950 3.465 N Pop4 n/a
5 TRCN0000287348 CCATGAACTCTGGAAACAGTA pLKO_005 504 CDS 100% 4.950 3.465 N Pop4 n/a
6 TRCN0000049879 CCTCTCCATGAACTCTGGAAA pLKO.1 499 CDS 100% 4.950 3.465 N POP4 n/a
7 TRCN0000098858 GCTATTATTTCAGTCACGAAA pLKO.1 610 CDS 100% 4.950 3.465 N Pop4 n/a
8 TRCN0000098855 CCTGACACTGAAGAACTGGAA pLKO.1 886 3UTR 100% 2.640 1.848 N Pop4 n/a
9 TRCN0000287346 CCTGACACTGAAGAACTGGAA pLKO_005 886 3UTR 100% 2.640 1.848 N Pop4 n/a
10 TRCN0000098859 GCAACAGAGATACAGCCTGTT pLKO.1 474 CDS 100% 0.405 0.284 N Pop4 n/a
11 TRCN0000287347 GCAACAGAGATACAGCCTGTT pLKO_005 474 CDS 100% 0.405 0.284 N Pop4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025390.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.