Transcript: Mouse NM_025430.3

Mus musculus mitochondrial ribosomal protein L35 (Mrpl35), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mrpl35 (66223)
Length:
3695
CDS:
27..593

Additional Resources:

NCBI RefSeq record:
NM_025430.3
NBCI Gene record:
Mrpl35 (66223)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025430.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191542 GCATTAAACATTCCCAGAGTT pLKO.1 721 3UTR 100% 4.950 6.930 N Mrpl35 n/a
2 TRCN0000249534 AGAGCTGCCTCAGGAATATTT pLKO_005 57 CDS 100% 15.000 10.500 N Mrpl35 n/a
3 TRCN0000249532 ATACCACAACAGTCCTTAATA pLKO_005 238 CDS 100% 15.000 10.500 N Mrpl35 n/a
4 TRCN0000249531 AGGAGAAAGGCTGGCTATAAG pLKO_005 396 CDS 100% 13.200 9.240 N Mrpl35 n/a
5 TRCN0000249535 GTTGTATCAGTAGGTTCATAT pLKO_005 1362 3UTR 100% 13.200 9.240 N Mrpl35 n/a
6 TRCN0000249533 TCGAACAAACCTACGAGTATA pLKO_005 572 CDS 100% 13.200 9.240 N Mrpl35 n/a
7 TRCN0000200671 GCTCTCTTAGTTGTATCAGTA pLKO.1 1353 3UTR 100% 4.950 3.465 N Mrpl35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025430.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.