Transcript: Mouse NM_025451.2

Mus musculus calcium/calmodulin-dependent protein kinase II inhibitor 1 (Camk2n1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Camk2n1 (66259)
Length:
3613
CDS:
39..275

Additional Resources:

NCBI RefSeq record:
NM_025451.2
NBCI Gene record:
Camk2n1 (66259)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255253 CGGAGCAAGCGCGTTGTTATT pLKO_005 192 CDS 100% 13.200 18.480 N Camk2n1 n/a
2 TRCN0000255252 TAGGATTGATGACGTGCTGAA pLKO_005 221 CDS 100% 4.050 5.670 N Camk2n1 n/a
3 TRCN0000255254 GCTTGCTACCTGCGATGAAAT pLKO_005 393 3UTR 100% 13.200 9.240 N Camk2n1 n/a
4 TRCN0000255255 CGTTGTTATTGAAGATGATAG pLKO_005 203 CDS 100% 10.800 7.560 N Camk2n1 n/a
5 TRCN0000037615 AGGATTGATGACGTGCTGAAA pLKO.1 222 CDS 100% 4.950 3.465 N CAMK2N1 n/a
6 TRCN0000219771 TATTGAAGATGATAGGATTGA pLKO.1 209 CDS 100% 4.950 3.465 N CAMK2N1 n/a
7 TRCN0000255251 GGACACCAACAACTTCTTCGG pLKO_005 128 CDS 100% 2.160 1.512 N Camk2n1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.