Transcript: Mouse NM_025483.4

Mus musculus SUMO1/sentrin specific peptidase 7 (Senp7), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Senp7 (66315)
Length:
4908
CDS:
136..3249

Additional Resources:

NCBI RefSeq record:
NM_025483.4
NBCI Gene record:
Senp7 (66315)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025483.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220533 CCCGTTCAGAAGTTGATTGTT pLKO.1 2326 CDS 100% 5.625 7.875 N Senp7 n/a
2 TRCN0000220529 GCTCCCTAAGTTTCCTAGAAA pLKO.1 3273 3UTR 100% 5.625 7.875 N Senp7 n/a
3 TRCN0000220530 CCAGAGTTATACTGACGGATA pLKO.1 605 CDS 100% 4.050 5.670 N Senp7 n/a
4 TRCN0000220532 CCGTTTCAAGTGTCCACAAAT pLKO.1 1750 CDS 100% 13.200 9.240 N Senp7 n/a
5 TRCN0000220531 GCAAACAGAATTAGGAAGAAA pLKO.1 630 CDS 100% 5.625 3.938 N Senp7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025483.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.