Transcript: Mouse NM_025487.3

Mus musculus keratin 88 (Krt88), mRNA.

Source:
NCBI, updated 2016-03-23
Taxon:
Mus musculus (mouse)
Gene:
Krt88 (66322)
Length:
903
CDS:
108..623

Additional Resources:

NCBI RefSeq record:
NM_025487.3
NBCI Gene record:
Krt88 (66322)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025487.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090461 GATGGAGCCTTGTGAACTACA pLKO.1 209 CDS 100% 4.950 3.960 N Krt88 n/a
2 TRCN0000090460 CAGTTCCTGTGGCCTGAACAT pLKO.1 518 CDS 100% 4.950 3.465 N Krt88 n/a
3 TRCN0000090459 GAATAGGCTCAACCAGGCTAT pLKO.1 176 CDS 100% 4.050 2.835 N Krt88 n/a
4 TRCN0000090462 GCCTGGACTTTGAGATCGCTA pLKO.1 379 CDS 100% 2.640 1.848 N Krt88 n/a
5 TRCN0000090458 GAAGACTAGAAACTGGCGCTT pLKO.1 639 3UTR 100% 2.160 1.512 N Krt88 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025487.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.