Transcript: Mouse NM_025495.3

Mus musculus centromere protein P (Cenpp), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cenpp (66336)
Length:
1054
CDS:
43..903

Additional Resources:

NCBI RefSeq record:
NM_025495.3
NBCI Gene record:
Cenpp (66336)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025495.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177398 GTAAACTTACTGGCTTCAATA pLKO.1 254 CDS 100% 13.200 18.480 N Cenpp n/a
2 TRCN0000181318 CCCAGATACTGTATACCTCTT pLKO.1 612 CDS 100% 4.050 5.670 N Cenpp n/a
3 TRCN0000197582 CGTGAGAACACATTTAAGCAT pLKO.1 577 CDS 100% 3.000 4.200 N Cenpp n/a
4 TRCN0000217114 CTAGACAGCCTGATAAGATTG pLKO.1 862 CDS 100% 10.800 8.640 N Cenpp n/a
5 TRCN0000200232 CGGAGCCTGGAAATCATTTCA pLKO.1 141 CDS 100% 5.625 3.938 N Cenpp n/a
6 TRCN0000197947 GAGCCTGGAAATCATTTCAAA pLKO.1 143 CDS 100% 5.625 3.938 N Cenpp n/a
7 TRCN0000176623 CCAAGATGGAAGACATTGTAA pLKO.1 287 CDS 100% 5.625 3.375 N Cenpp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025495.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.