Transcript: Mouse NM_025510.3

Mus musculus ADP-ribose/CDP-alcohol diphosphatase, manganese dependent (Adprm), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Adprm (66358)
Length:
1492
CDS:
209..1231

Additional Resources:

NCBI RefSeq record:
NM_025510.3
NBCI Gene record:
Adprm (66358)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025510.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121481 CTTCGGAGTTATAGCAGATAT pLKO.1 265 CDS 100% 13.200 18.480 N Adprm n/a
2 TRCN0000340617 TCCCTAAGTTCCGGTTCATTT pLKO_005 672 CDS 100% 13.200 18.480 N Adprm n/a
3 TRCN0000340694 TCGGAGTTATAGCAGATATTC pLKO_005 267 CDS 100% 13.200 18.480 N Adprm n/a
4 TRCN0000340696 CAGTTGTACTCTTAAGTATTC pLKO_005 1317 3UTR 100% 10.800 8.640 N Adprm n/a
5 TRCN0000340616 GTCAACCTTGAAGGAGTTATT pLKO_005 1088 CDS 100% 13.200 9.240 N Adprm n/a
6 TRCN0000340695 ACTATTACGCTTATCACTTTG pLKO_005 645 CDS 100% 10.800 7.560 N Adprm n/a
7 TRCN0000121477 CCTCATTATCTTGTCTGCTTT pLKO.1 1238 3UTR 100% 4.950 3.465 N Adprm n/a
8 TRCN0000121480 CGCAGATTTAGAAGATGGATA pLKO.1 292 CDS 100% 4.950 3.465 N Adprm n/a
9 TRCN0000121478 GCACAGTATAAAGTATCAGAA pLKO.1 449 CDS 100% 4.950 3.465 N Adprm n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025510.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.