Transcript: Mouse NM_025529.3

Mus musculus nudix (nucleoside diphosphate linked moiety X)-type motif 8 (Nudt8), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Nudt8 (66387)
Length:
786
CDS:
75..707

Additional Resources:

NCBI RefSeq record:
NM_025529.3
NBCI Gene record:
Nudt8 (66387)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081233 CCCGACGACCAAGATGTAATA pLKO.1 291 CDS 100% 13.200 18.480 N Nudt8 n/a
2 TRCN0000313622 TCCCGACGACCAAGATGTAAT pLKO_005 290 CDS 100% 13.200 18.480 N Nudt8 n/a
3 TRCN0000081236 GATGTAATACATACGGCCCTT pLKO.1 303 CDS 100% 2.160 3.024 N Nudt8 n/a
4 TRCN0000081235 GAGGAGGTGGATGAAGTATTT pLKO.1 474 CDS 100% 13.200 9.240 N Nudt8 n/a
5 TRCN0000317118 GAGGAGGTGGATGAAGTATTT pLKO_005 474 CDS 100% 13.200 9.240 N Nudt8 n/a
6 TRCN0000313621 CAACCATAGTCCCAGTACTTG pLKO_005 409 CDS 100% 4.950 3.465 N Nudt8 n/a
7 TRCN0000081234 GCAACCATAGTCCCAGTACTT pLKO.1 408 CDS 100% 4.950 3.465 N Nudt8 n/a
8 TRCN0000349915 AGCCAGTGTATGACCGGGAAA pLKO_005 385 CDS 100% 4.050 2.835 N Nudt8 n/a
9 TRCN0000081237 CGTTGCTCTACACGCTGCGTT pLKO.1 211 CDS 100% 0.880 0.616 N Nudt8 n/a
10 TRCN0000317179 CGTTGCTCTACACGCTGCGTT pLKO_005 211 CDS 100% 0.880 0.616 N Nudt8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.