Transcript: Mouse NM_025558.5

Mus musculus cytochrome b5 type B (Cyb5b), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cyb5b (66427)
Length:
4294
CDS:
52..492

Additional Resources:

NCBI RefSeq record:
NM_025558.5
NBCI Gene record:
Cyb5b (66427)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025558.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193401 CGCTATTCTTATAGGTTTCTT pLKO.1 435 CDS 100% 5.625 7.875 N Cyb5b n/a
2 TRCN0000350319 CGCTATTCTTATAGGTTTCTT pLKO_005 435 CDS 100% 5.625 7.875 N Cyb5b n/a
3 TRCN0000175530 CCTGTGATTTAGCAGTTGAAT pLKO.1 2182 3UTR 100% 5.625 3.938 N Cyb5b n/a
4 TRCN0000194147 GATGCAACTGAAAGCTTTGAA pLKO.1 256 CDS 100% 5.625 3.938 N Cyb5b n/a
5 TRCN0000314366 GATGCAACTGAAAGCTTTGAA pLKO_005 256 CDS 100% 5.625 3.938 N Cyb5b n/a
6 TRCN0000173725 CAAGGATCCTTCCAAGAACAA pLKO.1 369 CDS 100% 4.950 3.465 N Cyb5b n/a
7 TRCN0000314303 CAAGGATCCTTCCAAGAACAA pLKO_005 369 CDS 100% 4.950 3.465 N Cyb5b n/a
8 TRCN0000176294 CCAATGACTTAGAGTTCCTAT pLKO.1 764 3UTR 100% 4.950 3.465 N Cyb5b n/a
9 TRCN0000314367 CCAATGACTTAGAGTTCCTAT pLKO_005 764 3UTR 100% 4.950 3.465 N Cyb5b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025558.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.