Transcript: Mouse NM_025602.3

Mus musculus coiled-coil domain containing 59 (Ccdc59), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ccdc59 (52713)
Length:
1078
CDS:
24..746

Additional Resources:

NCBI RefSeq record:
NM_025602.3
NBCI Gene record:
Ccdc59 (52713)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025602.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190228 CTCTCAGGTCAGATTCGGAAA pLKO.1 89 CDS 100% 4.050 5.670 N Ccdc59 n/a
2 TRCN0000249586 GGGATCTCTCAGGTCAGATTC pLKO_005 84 CDS 100% 10.800 8.640 N Ccdc59 n/a
3 TRCN0000249585 GGCCAGCCTAACCTGAATTTA pLKO_005 684 CDS 100% 15.000 10.500 N Ccdc59 n/a
4 TRCN0000249588 GTATGGGAACCTCCTAATAAT pLKO_005 806 3UTR 100% 15.000 10.500 N Ccdc59 n/a
5 TRCN0000249584 CGAAGCGTGCTGCTAAGAAAT pLKO_005 562 CDS 100% 13.200 9.240 N Ccdc59 n/a
6 TRCN0000249587 ACAGTTAAAGCGGACACTTTG pLKO_005 739 CDS 100% 10.800 7.560 N Ccdc59 n/a
7 TRCN0000202078 CCGAAGAGGAAAGACTCAGAA pLKO.1 319 CDS 100% 4.950 3.465 N Ccdc59 n/a
8 TRCN0000200805 GCCTAACCTGAATTTACAGAT pLKO.1 689 CDS 100% 4.950 3.465 N Ccdc59 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025602.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.