Transcript: Mouse NM_025610.3

Mus musculus asparaginase like 1 (Asrgl1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Asrgl1 (66514)
Length:
2274
CDS:
13..993

Additional Resources:

NCBI RefSeq record:
NM_025610.3
NBCI Gene record:
Asrgl1 (66514)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025610.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032313 CCCGTTAAACTTGCACGGCTT pLKO.1 364 CDS 100% 2.160 3.024 N Asrgl1 n/a
2 TRCN0000032309 CCTGAATGTAAACGGTGATAT pLKO.1 267 CDS 100% 13.200 10.560 N Asrgl1 n/a
3 TRCN0000032310 GCTGGAGGTTACGCAGATAAT pLKO.1 676 CDS 100% 13.200 10.560 N Asrgl1 n/a
4 TRCN0000032311 CCAGAGTTCAACGCAGGTTAT pLKO.1 238 CDS 100% 10.800 7.560 N Asrgl1 n/a
5 TRCN0000032312 CATTGGATTACATGAAGTCAA pLKO.1 815 CDS 100% 4.950 3.465 N Asrgl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025610.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.