Transcript: Mouse NM_025611.5

Mus musculus cullin 7 (Cul7), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Cul7 (66515)
Length:
5546
CDS:
387..5456

Additional Resources:

NCBI RefSeq record:
NM_025611.5
NBCI Gene record:
Cul7 (66515)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025611.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321187 GGACTATGCGGTGATACTAAA pLKO_005 2543 CDS 100% 13.200 18.480 N Cul7 n/a
2 TRCN0000415310 GCAGCGTCAGTTCCACGTTTA pLKO_005 4265 CDS 100% 10.800 15.120 N Cul7 n/a
3 TRCN0000012719 CTCGTCTATCTGGTGCTAGAA pLKO.1 5121 CDS 100% 4.950 6.930 N Cul7 n/a
4 TRCN0000378994 ACAGCATCAAGTCCGTTAATA pLKO_005 3055 CDS 100% 15.000 12.000 N Cul7 n/a
5 TRCN0000416932 CCAGGTGCCCAGCCAAATTTA pLKO_005 2103 CDS 100% 15.000 10.500 N Cul7 n/a
6 TRCN0000012718 GCGCTATTATAAAGGAACAAT pLKO.1 4496 CDS 100% 5.625 3.938 N Cul7 n/a
7 TRCN0000012720 CAGGTGCTGTACTATGCAGTT pLKO.1 5283 CDS 100% 4.050 2.835 N Cul7 n/a
8 TRCN0000321186 CAGGTGCTGTACTATGCAGTT pLKO_005 5283 CDS 100% 4.050 2.835 N Cul7 n/a
9 TRCN0000012721 CCTCAGACATACCTACAAGCT pLKO.1 4995 CDS 100% 2.640 1.848 N Cul7 n/a
10 TRCN0000321185 CCTCAGACATACCTACAAGCT pLKO_005 4995 CDS 100% 2.640 1.848 N Cul7 n/a
11 TRCN0000012722 GCTTAGAGAAAGAGCCACAGA pLKO.1 4669 CDS 100% 2.640 1.848 N Cul7 n/a
12 TRCN0000321116 GCTTAGAGAAAGAGCCACAGA pLKO_005 4669 CDS 100% 2.640 1.848 N Cul7 n/a
13 TRCN0000426813 GTCCTGGAAAGACGATGATTT pLKO_005 3806 CDS 100% 13.200 7.920 N Cul7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025611.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.