Transcript: Mouse NM_025636.5

Mus musculus nucleoside-triphosphatase, cancer-related (Ntpcr), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ntpcr (66566)
Length:
1155
CDS:
114..686

Additional Resources:

NCBI RefSeq record:
NM_025636.5
NBCI Gene record:
Ntpcr (66566)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025636.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241016 TGCATGCGGTTTGAGTAAATT pLKO_005 845 3UTR 100% 15.000 21.000 N Ntpcr n/a
2 TRCN0000241017 CTGTCCACACCAGGCATTATC pLKO_005 510 CDS 100% 13.200 18.480 N Ntpcr n/a
3 TRCN0000183150 GCGGTTTGAGTAAATTCTAAA pLKO.1 850 3UTR 100% 13.200 18.480 N Ntpcr n/a
4 TRCN0000245386 ACAGCCTCTTGCCAGATATTG pLKO_005 637 CDS 100% 13.200 9.240 N Ntpcr n/a
5 TRCN0000241015 GCACTTCCTGTCCTAAGAAAC pLKO_005 387 CDS 100% 10.800 7.560 N Ntpcr n/a
6 TRCN0000245385 GTGACGTGAAGGTGTTCAATG pLKO_005 598 CDS 100% 10.800 7.560 N Ntpcr n/a
7 TRCN0000179805 CCAAACACAGAGTGTGTATCA pLKO.1 427 CDS 100% 4.950 3.465 N Ntpcr n/a
8 TRCN0000184675 CAACCTTGATCCAGAAAGCCA pLKO.1 160 CDS 100% 0.750 0.525 N Ntpcr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025636.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.