Transcript: Mouse NM_025637.3

Mus musculus RWD domain containing 3 (Rwdd3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rwdd3 (66568)
Length:
1698
CDS:
20..1039

Additional Resources:

NCBI RefSeq record:
NM_025637.3
NBCI Gene record:
Rwdd3 (66568)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025637.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200103 CAAATAGTCGGCATCCACCAT pLKO.1 143 CDS 100% 2.640 3.696 N Rwdd3 n/a
2 TRCN0000182461 GCATTTGTGTATCACGTCCCT pLKO.1 166 CDS 100% 0.660 0.924 N Rwdd3 n/a
3 TRCN0000177824 CCATAAGCATTTGTGTATCAC pLKO.1 160 CDS 100% 4.950 3.960 N Rwdd3 n/a
4 TRCN0000177764 CAGTCAGGAAATGCTTGTTAA pLKO.1 228 CDS 100% 13.200 9.240 N Rwdd3 n/a
5 TRCN0000181221 CATGGAGACCTTCTCTTCTAA pLKO.1 295 CDS 100% 5.625 3.938 N Rwdd3 n/a
6 TRCN0000181682 CAGCCATGAGAAGTGCACTTT pLKO.1 601 CDS 100% 4.950 3.465 N Rwdd3 n/a
7 TRCN0000198092 CAACATCAAGGAGTACCTGAT pLKO.1 799 CDS 100% 4.050 2.835 N Rwdd3 n/a
8 TRCN0000181396 CCAGTTGGTTACCCTTTGTGT pLKO.1 407 CDS 100% 3.000 2.100 N Rwdd3 n/a
9 TRCN0000182332 GAAGGCAGTCAGGAAATGCTT pLKO.1 223 CDS 100% 3.000 2.100 N Rwdd3 n/a
10 TRCN0000198993 GAAATGCTTGTTAAGGCTGCT pLKO.1 235 CDS 100% 2.160 1.512 N Rwdd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025637.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.