Transcript: Mouse NM_025663.4

Mus musculus G patch domain containing 4 (Gpatch4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Gpatch4 (66614)
Length:
1771
CDS:
259..1506

Additional Resources:

NCBI RefSeq record:
NM_025663.4
NBCI Gene record:
Gpatch4 (66614)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025663.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249542 ATGACCCTGCCAAGGAATTTA pLKO_005 419 CDS 100% 15.000 10.500 N Gpatch4 n/a
2 TRCN0000249544 GGAGAGCCAATGCATTCTATA pLKO_005 1585 3UTR 100% 13.200 9.240 N Gpatch4 n/a
3 TRCN0000249543 AGGTGAGAGAAGTCGGCAATA pLKO_005 1419 CDS 100% 10.800 7.560 N Gpatch4 n/a
4 TRCN0000249541 AGTGCAGATAAGACGTCTTTC pLKO_005 510 CDS 100% 10.800 7.560 N Gpatch4 n/a
5 TRCN0000178856 CCCAAAGATTCTGACTGATGA pLKO.1 675 CDS 100% 4.950 3.465 N Gpatch4 n/a
6 TRCN0000184510 GCAGTAAAGATGATGGTGGGA pLKO.1 1379 CDS 100% 0.660 0.462 N Gpatch4 n/a
7 TRCN0000249540 GACTTAGATGTAAGCAGTAAA pLKO_005 1366 CDS 100% 13.200 6.600 Y Gpatch4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025663.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.