Transcript: Mouse NM_025679.3

Mus musculus suppressor of IKBKE 1 (Sike1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Sike1 (66641)
Length:
2798
CDS:
70..693

Additional Resources:

NCBI RefSeq record:
NM_025679.3
NBCI Gene record:
Sike1 (66641)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025679.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264902 CGGTGCCCTGTGTCGTATAAA pLKO_005 2175 3UTR 100% 15.000 10.500 N Sike1 n/a
2 TRCN0000216205 CGTGAAGGACATGTCTAAATA pLKO.1 249 CDS 100% 15.000 10.500 N Sike1 n/a
3 TRCN0000264904 ACGTGAAGGACATGTCTAAAT pLKO_005 248 CDS 100% 13.200 9.240 N Sike1 n/a
4 TRCN0000215628 GGAAACAGATGTTACAGTTAA pLKO.1 395 CDS 100% 13.200 9.240 N Sike1 n/a
5 TRCN0000264903 AGCTGTTCAGGTGGACGATAA pLKO_005 531 CDS 100% 10.800 7.560 N Sike1 n/a
6 TRCN0000264906 ATAAGGAACTTCGAGAGTTAC pLKO_005 599 CDS 100% 10.800 7.560 N Sike1 n/a
7 TRCN0000264905 ATACCCAGATTAGAGACTTAC pLKO_005 299 CDS 100% 10.800 7.560 N Sike1 n/a
8 TRCN0000216599 GAAAGTCAGATCGATAGAATC pLKO.1 484 CDS 100% 10.800 7.560 N Sike1 n/a
9 TRCN0000183308 GCACATTGAATGGAGAAAGAA pLKO.1 2236 3UTR 100% 5.625 3.938 N Sike1 n/a
10 TRCN0000183266 GATAACCAATTCTGTAAGGTT pLKO.1 547 CDS 100% 3.000 2.100 N Sike1 n/a
11 TRCN0000183802 CTCAAGAGAATACCCAGATTA pLKO.1 290 CDS 100% 13.200 7.920 N Sike1 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1530 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025679.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.