Transcript: Mouse NM_025684.2

Mus musculus nephrocan (Nepn), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Nepn (66650)
Length:
1823
CDS:
33..1571

Additional Resources:

NCBI RefSeq record:
NM_025684.2
NBCI Gene record:
Nepn (66650)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025684.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419233 CCGGATCTCGGCCTTAGATTT pLKO_005 1235 CDS 100% 13.200 18.480 N Nepn n/a
2 TRCN0000179395 GCACAAGTGTGCTATCATTTA pLKO.1 1625 3UTR 100% 13.200 18.480 N Nepn n/a
3 TRCN0000425031 ACAACCAACTCCACCTTATAC pLKO_005 616 CDS 100% 13.200 10.560 N Nepn n/a
4 TRCN0000432646 AGCCAACCTTGAGGTGTTAAA pLKO_005 377 CDS 100% 13.200 9.240 N Nepn n/a
5 TRCN0000424694 CCCAAATCCTTGCTATCTTTA pLKO_005 720 CDS 100% 13.200 9.240 N Nepn n/a
6 TRCN0000180679 GACGATGCAGTTGTGATTCTA pLKO.1 100 CDS 100% 5.625 3.938 N Nepn n/a
7 TRCN0000179197 GAATTTGCAGTTCCTCAGTTT pLKO.1 662 CDS 100% 4.950 3.465 N Nepn n/a
8 TRCN0000180556 GCATCTCAAGTACATGAGCAT pLKO.1 590 CDS 100% 2.640 1.848 N Nepn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025684.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.