Transcript: Mouse NM_025728.4

Mus musculus sperm associated antigen 16 (Spag16), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Spag16 (66722)
Length:
1303
CDS:
181..1113

Additional Resources:

NCBI RefSeq record:
NM_025728.4
NBCI Gene record:
Spag16 (66722)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025728.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115511 GCATTCCCTCTAAGGCTTAAA pLKO.1 1142 3UTR 100% 13.200 10.560 N Spag16 n/a
2 TRCN0000115512 CGGTGCAGATACACTTTGTAT pLKO.1 622 CDS 100% 5.625 4.500 N Spag16 n/a
3 TRCN0000115514 CCTCACTGGATATGACGAGTA pLKO.1 578 CDS 100% 4.050 2.835 N Spag16 n/a
4 TRCN0000115513 CCAACATTCTTCTCACCGCTT pLKO.1 686 CDS 100% 2.160 1.512 N Spag16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025728.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.