Transcript: Mouse NM_025770.3

Mus musculus autophagy related 10 (Atg10), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Atg10 (66795)
Length:
1609
CDS:
61..696

Additional Resources:

NCBI RefSeq record:
NM_025770.3
NBCI Gene record:
Atg10 (66795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192097 CCAATACTTGGGCAACCATTT pLKO.1 505 CDS 100% 10.800 15.120 N Atg10 n/a
2 TRCN0000350209 CCAATACTTGGGCAACCATTT pLKO_005 505 CDS 100% 10.800 15.120 N Atg10 n/a
3 TRCN0000192489 CCAGTGGTTGGTCTGAATTTA pLKO.1 637 CDS 100% 15.000 12.000 N Atg10 n/a
4 TRCN0000319975 CCAGTGGTTGGTCTGAATTTA pLKO_005 637 CDS 100% 15.000 12.000 N Atg10 n/a
5 TRCN0000200892 CTCTGAGCTATGCTAAAGCAA pLKO.1 659 CDS 100% 3.000 2.400 N Atg10 n/a
6 TRCN0000319976 CTCTGAGCTATGCTAAAGCAA pLKO_005 659 CDS 100% 3.000 2.400 N Atg10 n/a
7 TRCN0000200999 CATCAGACATTCACAGCAGAT pLKO.1 114 CDS 100% 4.050 2.835 N Atg10 n/a
8 TRCN0000319974 CATCAGACATTCACAGCAGAT pLKO_005 114 CDS 100% 4.050 2.835 N Atg10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.