Transcript: Mouse NM_025811.3

Mus musculus NHL repeat containing 2 (Nhlrc2), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Nhlrc2 (66866)
Length:
3934
CDS:
423..2600

Additional Resources:

NCBI RefSeq record:
NM_025811.3
NBCI Gene record:
Nhlrc2 (66866)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025811.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183901 CCTGTGGTTAACGATGCAGAT pLKO.1 852 CDS 100% 4.050 5.670 N Nhlrc2 n/a
2 TRCN0000179029 CGACTCCTACAATCACAAGAT pLKO.1 1898 CDS 100% 4.950 3.960 N Nhlrc2 n/a
3 TRCN0000217782 CCAAGTCATTGACCATCATTT pLKO.1 2775 3UTR 100% 13.200 9.240 N Nhlrc2 n/a
4 TRCN0000217826 CTTCACCTACTGCTGCATAAA pLKO.1 677 CDS 100% 13.200 9.240 N Nhlrc2 n/a
5 TRCN0000217872 GACACTGAGAACCACCTTATA pLKO.1 1305 CDS 100% 13.200 9.240 N Nhlrc2 n/a
6 TRCN0000183106 CCATGCTATATCAGAGAGTAT pLKO.1 2844 3UTR 100% 4.950 3.465 N Nhlrc2 n/a
7 TRCN0000184652 GCACCATAGGATCTTGGTCAT pLKO.1 1154 CDS 100% 4.050 2.835 N Nhlrc2 n/a
8 TRCN0000184247 GCAGATTCCTACCCATTGCTT pLKO.1 2420 CDS 100% 3.000 2.100 N Nhlrc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025811.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.