Transcript: Mouse NM_025823.4

Mus musculus prenylcysteine oxidase 1 (Pcyox1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Pcyox1 (66881)
Length:
4291
CDS:
67..1584

Additional Resources:

NCBI RefSeq record:
NM_025823.4
NBCI Gene record:
Pcyox1 (66881)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025823.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311472 ACGTGAAGATTGACGTGTTTG pLKO_005 245 CDS 100% 10.800 15.120 N Pcyox1 n/a
2 TRCN0000076658 CGGCTTTATCAGGGATAGATT pLKO.1 2319 3UTR 100% 5.625 7.875 N Pcyox1 n/a
3 TRCN0000326167 CGGCTTTATCAGGGATAGATT pLKO_005 2319 3UTR 100% 5.625 7.875 N Pcyox1 n/a
4 TRCN0000076661 CGTAATGTCAATAGAGGAGAA pLKO.1 885 CDS 100% 4.050 5.670 N Pcyox1 n/a
5 TRCN0000076659 CCAACATAACTTTCCGAAATT pLKO.1 1031 CDS 100% 13.200 9.240 N Pcyox1 n/a
6 TRCN0000326219 CCAACATAACTTTCCGAAATT pLKO_005 1031 CDS 100% 13.200 9.240 N Pcyox1 n/a
7 TRCN0000076662 GCTCTTCCTGTCCTATGATTA pLKO.1 1326 CDS 100% 13.200 9.240 N Pcyox1 n/a
8 TRCN0000326218 GCTCTTCCTGTCCTATGATTA pLKO_005 1326 CDS 100% 13.200 9.240 N Pcyox1 n/a
9 TRCN0000076660 CGCCTATTATCTAAGGAAGAA pLKO.1 213 CDS 100% 4.950 3.465 N Pcyox1 n/a
10 TRCN0000306214 CTCCTGTCATGAAGGTCAATT pLKO_005 719 CDS 100% 13.200 7.920 N Pcyox1 n/a
11 TRCN0000019265 GAACCGGAAGATGTCCAACAA pLKO.1 1017 CDS 100% 4.950 3.465 N GATA2 n/a
12 TRCN0000181017 GCACATGCCTTTAATCCCAAT pLKO.1 4113 3UTR 100% 4.050 2.025 Y Map6d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025823.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.