Transcript: Mouse NM_025836.3

Mus musculus perilipin 3 (Plin3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Plin3 (66905)
Length:
2159
CDS:
76..1389

Additional Resources:

NCBI RefSeq record:
NM_025836.3
NBCI Gene record:
Plin3 (66905)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025836.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247805 GCCTGATGGAATCCGTGAAAC pLKO_005 917 CDS 100% 10.800 15.120 N Plin3 n/a
2 TRCN0000247802 CTGCGCAATCACGCCTATGAA pLKO_005 823 CDS 100% 5.625 7.875 N Plin3 n/a
3 TRCN0000247803 GTGTGGGACAGATGGTGATTA pLKO_005 626 CDS 100% 13.200 10.560 N Plin3 n/a
4 TRCN0000247806 CCGGCTGCCACATCACAAATT pLKO_005 1706 3UTR 100% 13.200 9.240 N Plin3 n/a
5 TRCN0000247804 GACAGGAGCAGAACTACTTTG pLKO_005 776 CDS 100% 10.800 7.560 N Plin3 n/a
6 TRCN0000174455 CTCAAGAAATGGTATCTAGCT pLKO.1 470 CDS 100% 2.640 1.848 N Plin3 n/a
7 TRCN0000174422 CACATCACAAATTCAGTGATA pLKO.1 1714 3UTR 100% 0.495 0.347 N Plin3 n/a
8 TRCN0000193425 CCACATCACAAATTCAGTGAT pLKO.1 1713 3UTR 100% 0.495 0.347 N Plin3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025836.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.