Transcript: Mouse NM_025897.2

Mus musculus ribosomal RNA processing 8, methyltransferase, homolog (yeast) (Rrp8), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rrp8 (101867)
Length:
2856
CDS:
189..1562

Additional Resources:

NCBI RefSeq record:
NM_025897.2
NBCI Gene record:
Rrp8 (101867)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025897.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000297560 GCCCGATTTCGCTACCTTAAT pLKO_005 936 CDS 100% 13.200 18.480 N Rrp8 n/a
2 TRCN0000278772 CCAGCTCAGCTCTACTCTAAT pLKO_005 1694 3UTR 100% 13.200 9.240 N Rrp8 n/a
3 TRCN0000174042 CCCTGAGTCTATGTCACCTAA pLKO.1 704 CDS 100% 4.950 3.465 N Rrp8 n/a
4 TRCN0000278770 CCCTGAGTCTATGTCACCTAA pLKO_005 704 CDS 100% 4.950 3.465 N Rrp8 n/a
5 TRCN0000193403 CGGCTTTAAGATTATCTACAA pLKO.1 1421 CDS 100% 4.950 3.465 N Rrp8 n/a
6 TRCN0000278827 CGGCTTTAAGATTATCTACAA pLKO_005 1421 CDS 100% 4.950 3.465 N Rrp8 n/a
7 TRCN0000173871 GCCTTTCACTGATGGGAACTA pLKO.1 1279 CDS 100% 4.950 3.465 N Rrp8 n/a
8 TRCN0000278769 GCCTTTCACTGATGGGAACTA pLKO_005 1279 CDS 100% 4.950 3.465 N Rrp8 n/a
9 TRCN0000173290 GTCCCAAAGTCAGATAGTCAA pLKO.1 864 CDS 100% 4.950 3.465 N Rrp8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025897.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.