Transcript: Mouse NM_025923.3

Mus musculus Fanconi anemia, complementation group L (Fancl), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Fancl (67030)
Length:
1798
CDS:
132..1259

Additional Resources:

NCBI RefSeq record:
NM_025923.3
NBCI Gene record:
Fancl (67030)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025923.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040545 GCTCCTTGGTAGATGTTTATA pLKO.1 673 CDS 100% 15.000 10.500 N Fancl n/a
2 TRCN0000335379 GCTCCTTGGTAGATGTTTATA pLKO_005 673 CDS 100% 15.000 10.500 N Fancl n/a
3 TRCN0000040547 CAGCTCAAGAAGGCAAGATTA pLKO.1 270 CDS 100% 13.200 9.240 N Fancl n/a
4 TRCN0000040546 CCTACCATGCTTCCTGAGTTT pLKO.1 864 CDS 100% 4.950 3.465 N Fancl n/a
5 TRCN0000363836 CCTACCATGCTTCCTGAGTTT pLKO_005 864 CDS 100% 4.950 3.465 N Fancl n/a
6 TRCN0000040544 GCACCTAATCACTGTCAAGTT pLKO.1 572 CDS 100% 4.950 3.465 N Fancl n/a
7 TRCN0000335378 GCACCTAATCACTGTCAAGTT pLKO_005 572 CDS 100% 4.950 3.465 N Fancl n/a
8 TRCN0000040543 GCTCGTAGTATCTTGGAAGAA pLKO.1 1011 CDS 100% 4.950 3.465 N Fancl n/a
9 TRCN0000335448 GCTCGTAGTATCTTGGAAGAA pLKO_005 1011 CDS 100% 4.950 3.465 N Fancl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025923.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.