Transcript: Mouse NM_025958.2

Mus musculus cullin-associated and neddylation-dissociated 2 (putative) (Cand2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Cand2 (67088)
Length:
5453
CDS:
55..3762

Additional Resources:

NCBI RefSeq record:
NM_025958.2
NBCI Gene record:
Cand2 (67088)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025958.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108581 CGACAACTTAAAGACCGGAAT pLKO.1 1378 CDS 100% 4.050 5.670 N Cand2 n/a
2 TRCN0000108582 GCACCTGTTTACAACCAGGTT pLKO.1 2398 CDS 100% 0.264 0.370 N Cand2 n/a
3 TRCN0000108580 GCCAGTTATCTGAGTTAATAA pLKO.1 4371 3UTR 100% 15.000 10.500 N Cand2 n/a
4 TRCN0000108584 CGACCTAGAACCCACACTTAT pLKO.1 1875 CDS 100% 13.200 9.240 N Cand2 n/a
5 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 5100 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025958.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.