Transcript: Mouse NM_025972.4

Mus musculus N-acylethanolamine acid amidase (Naaa), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Naaa (67111)
Length:
2424
CDS:
50..1138

Additional Resources:

NCBI RefSeq record:
NM_025972.4
NBCI Gene record:
Naaa (67111)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025972.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101763 CCGAGTTGAGACAAATTATGA pLKO.1 910 CDS 100% 5.625 7.875 N Naaa n/a
2 TRCN0000101761 GCTGACGTTTATTACATTGTT pLKO.1 794 CDS 100% 5.625 7.875 N Naaa n/a
3 TRCN0000101762 GCCAAAGTCCACACAAGTTTA pLKO.1 612 CDS 100% 13.200 9.240 N Naaa n/a
4 TRCN0000101760 CCGATAGATAGATAGATGATA pLKO.1 1506 3UTR 100% 5.625 3.938 N Naaa n/a
5 TRCN0000101764 GTTGAGACAAATTATGACCAT pLKO.1 914 CDS 100% 2.640 1.848 N Naaa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025972.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.