Transcript: Mouse NM_025984.2

Mus musculus late cornified envelope 1A1 (Lce1a1), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Lce1a1 (67127)
Length:
711
CDS:
75..506

Additional Resources:

NCBI RefSeq record:
NM_025984.2
NBCI Gene record:
Lce1a1 (67127)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257960 CAACTAACACTTTAGACAAAC pLKO_005 513 3UTR 100% 10.800 6.480 N Lce1a1 n/a
2 TRCN0000257949 GTGTCTTCCTGCTGTAGTCTG pLKO_005 192 CDS 100% 4.050 2.430 N Lce1a1 n/a
3 TRCN0000250013 ACCTGAGCAACTAACACTTTA pLKO_005 506 CDS 100% 13.200 6.600 Y Lce1a2 n/a
4 TRCN0000249794 CTGCTGACCTGAGCAACTAAC pLKO_005 500 CDS 100% 10.800 5.400 Y Lce1a1 n/a
5 TRCN0000250014 CGCCATAGCTCTGGATGTTGT pLKO_005 336 CDS 100% 4.950 2.475 Y Lce1a2 n/a
6 TRCN0000249792 TCGCCATAGCTCTGGATGTTG pLKO_005 335 CDS 100% 4.950 2.475 Y Lce1a1 n/a
7 TRCN0000249793 CTAAGTGTCCTCCCAAGTGTC pLKO_005 166 CDS 100% 4.050 2.025 Y Lce1a1 n/a
8 TRCN0000250015 ATGTTGTAGCAGTGGTGGCAG pLKO_005 350 CDS 100% 2.160 1.080 Y Lce1a2 n/a
9 TRCN0000250012 CCCTAAGTGTCCTCCCAAGTG pLKO_005 164 CDS 100% 1.350 0.675 Y Lce1a2 n/a
10 TRCN0000249510 GGTTGTTGTGGCTCCAGCTCT pLKO_005 222 CDS 100% 0.880 0.440 Y Lce1b n/a
11 TRCN0000249508 TGTAGCAGTGGTGGCAGCAGT pLKO_005 354 CDS 100% 0.880 0.440 Y Lce1b n/a
12 TRCN0000249512 TGTGGCAGTAGCCAGCAGTCT pLKO_005 471 CDS 100% 0.880 0.440 Y Lce1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.