Transcript: Mouse NM_025988.2

Mus musculus acyl-Coenzyme A binding domain containing 4 (Acbd4), transcript variant 1, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Acbd4 (67131)
Length:
2081
CDS:
554..1543

Additional Resources:

NCBI RefSeq record:
NM_025988.2
NBCI Gene record:
Acbd4 (67131)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025988.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191512 GCAGAGGATATGTTTGGTTAT pLKO.1 872 CDS 100% 10.800 7.560 N Acbd4 n/a
2 TRCN0000140531 GAAGAGATGCTGCGATTCTAC pLKO.1 656 CDS 100% 4.950 3.465 N ACBD4 n/a
3 TRCN0000190019 GCTGCGATTCTACAGCTACTA pLKO.1 664 CDS 100% 4.950 3.465 N Acbd4 n/a
4 TRCN0000202346 GTCTGCCTACATCTCTGAGAT pLKO.1 802 CDS 100% 4.950 3.465 N Acbd4 n/a
5 TRCN0000189514 CAGGAAAGCATGAAGGACGTT pLKO.1 1355 CDS 100% 2.640 1.848 N Acbd4 n/a
6 TRCN0000122717 CCTATGAAGAGATGCTGCGAT pLKO.1 651 CDS 100% 2.640 1.848 N ACBD4 n/a
7 TRCN0000202438 GCTCCCATAAGACCCATCTTT pLKO.1 1696 3UTR 100% 5.625 3.375 N Acbd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025988.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.