Transcript: Mouse NM_026048.4

Mus musculus cyclin-dependent kinase 2 interacting protein (Cinp), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cinp (67236)
Length:
2029
CDS:
74..712

Additional Resources:

NCBI RefSeq record:
NM_026048.4
NBCI Gene record:
Cinp (67236)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026048.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088370 GCTGCTGACTGGCATAACTTA pLKO.1 152 CDS 100% 5.625 7.875 N Cinp n/a
2 TRCN0000308797 GCTGCTGACTGGCATAACTTA pLKO_005 152 CDS 100% 5.625 7.875 N Cinp n/a
3 TRCN0000088371 AGGGAATTTGTGAGCTAGAAA pLKO.1 423 CDS 100% 5.625 4.500 N Cinp n/a
4 TRCN0000308801 AGGGAATTTGTGAGCTAGAAA pLKO_005 423 CDS 100% 5.625 4.500 N Cinp n/a
5 TRCN0000088368 CCCAGGATTATTAGATGTTAA pLKO.1 1124 3UTR 100% 13.200 9.240 N Cinp n/a
6 TRCN0000308798 CCCAGGATTATTAGATGTTAA pLKO_005 1124 3UTR 100% 13.200 9.240 N Cinp n/a
7 TRCN0000088369 GCTCTCTGAAGCATACAAGAA pLKO.1 526 CDS 100% 4.950 3.465 N Cinp n/a
8 TRCN0000308800 GCTCTCTGAAGCATACAAGAA pLKO_005 526 CDS 100% 4.950 3.465 N Cinp n/a
9 TRCN0000088372 GCTTCCATGGAAGAGGAAGAA pLKO.1 287 CDS 100% 0.495 0.297 N Cinp n/a
10 TRCN0000308881 GCTTCCATGGAAGAGGAAGAA pLKO_005 287 CDS 100% 0.495 0.297 N Cinp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026048.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.