Transcript: Mouse NM_026067.3

Mus musculus exoribonuclease 1 (Eri1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Eri1 (67276)
Length:
5067
CDS:
167..1204

Additional Resources:

NCBI RefSeq record:
NM_026067.3
NBCI Gene record:
Eri1 (67276)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026067.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321299 AGGCGAATGAATCTGAGTTAA pLKO_005 1241 3UTR 100% 13.200 18.480 N Eri1 n/a
2 TRCN0000321298 CACCTTAGAAATCGAAGATAC pLKO_005 640 CDS 100% 10.800 15.120 N Eri1 n/a
3 TRCN0000009660 CGCAATGACAAACGGTTGTAT pLKO.1 361 CDS 100% 5.625 7.875 N Eri1 n/a
4 TRCN0000009662 CGCTAAGAAGTGGATCAATAT pLKO.1 913 CDS 100% 13.200 9.240 N Eri1 n/a
5 TRCN0000321230 CGCTAAGAAGTGGATCAATAT pLKO_005 913 CDS 100% 13.200 9.240 N Eri1 n/a
6 TRCN0000009659 GCCAGACCAAACTAACAATAA pLKO.1 972 CDS 100% 13.200 9.240 N Eri1 n/a
7 TRCN0000321297 GCCAGACCAAACTAACAATAA pLKO_005 972 CDS 100% 13.200 9.240 N Eri1 n/a
8 TRCN0000433701 TGACTTCAGTGACCCGGTTTA pLKO_005 331 CDS 100% 10.800 7.560 N ERI1 n/a
9 TRCN0000009661 GCTTGAAACAAGAGGAGTCAA pLKO.1 430 CDS 100% 4.950 3.465 N Eri1 n/a
10 TRCN0000321229 GCTTGAAACAAGAGGAGTCAA pLKO_005 430 CDS 100% 4.950 3.465 N Eri1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026067.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.