Transcript: Mouse NM_026072.1

Mus musculus CWC27 spliceosome-associated protein (Cwc27), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Cwc27 (67285)
Length:
1884
CDS:
226..1635

Additional Resources:

NCBI RefSeq record:
NM_026072.1
NBCI Gene record:
Cwc27 (67285)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026072.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251243 AGTGCAGAGCGTGACGAATAC pLKO_005 1024 CDS 100% 10.800 15.120 N Cwc27 n/a
2 TRCN0000267411 GCACTACTGAGCCAGTTTAAA pLKO_005 1375 CDS 100% 15.000 10.500 N Cwc27 n/a
3 TRCN0000251242 ACGCCTGACAGAAGTAGATAT pLKO_005 651 CDS 100% 13.200 9.240 N Cwc27 n/a
4 TRCN0000251241 GGGCCGAGCAGATGAACTTAA pLKO_005 576 CDS 100% 13.200 9.240 N Cwc27 n/a
5 TRCN0000251244 CCTGTCACAGCCATGTCTATG pLKO_005 1679 3UTR 100% 10.800 7.560 N Cwc27 n/a
6 TRCN0000000136 CGAGCAGATGAACTTAACAAT pLKO.1 580 CDS 100% 5.625 3.938 N CWC27 n/a
7 TRCN0000338374 CGAGCAGATGAACTTAACAAT pLKO_005 580 CDS 100% 5.625 3.938 N CWC27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026072.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.