Transcript: Mouse NM_026103.1

Mus musculus V-set and immunoglobulin domain containing 1 (Vsig1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Vsig1 (78789)
Length:
2482
CDS:
164..1066

Additional Resources:

NCBI RefSeq record:
NM_026103.1
NBCI Gene record:
Vsig1 (78789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026103.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111156 CCCAACAAAGTGAGGCAATTT pLKO.1 699 CDS 100% 13.200 18.480 N Vsig1 n/a
2 TRCN0000111155 GCAACATTTGAGCATAGCATT pLKO.1 1647 3UTR 100% 4.950 6.930 N Vsig1 n/a
3 TRCN0000111159 GCAATTCAAAGACCGAATAAT pLKO.1 100 5UTR 100% 15.000 12.000 N Vsig1 n/a
4 TRCN0000111158 CCATCAACAGTCTTGGCAATA pLKO.1 486 CDS 100% 10.800 7.560 N Vsig1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026103.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.