Transcript: Mouse NM_026192.3

Mus musculus calcium binding and coiled coil domain 1 (Calcoco1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Calcoco1 (67488)
Length:
2840
CDS:
157..2232

Additional Resources:

NCBI RefSeq record:
NM_026192.3
NBCI Gene record:
Calcoco1 (67488)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026192.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244544 CCTTGCGGGAATAGAATTATT pLKO_005 2514 3UTR 100% 15.000 21.000 N Calcoco1 n/a
2 TRCN0000245394 ACCCATGCCAGTGTCCAATTC pLKO_005 391 CDS 100% 10.800 8.640 N Calcoco1 n/a
3 TRCN0000241034 GAGGAGAACTGCTGCTTAAAT pLKO_005 1027 CDS 100% 15.000 10.500 N Calcoco1 n/a
4 TRCN0000244545 AGCTGCCTGCGTTCGAGATTA pLKO_005 318 CDS 100% 13.200 9.240 N Calcoco1 n/a
5 TRCN0000179471 GCCTTCTTCTCTTGTTGTCAT pLKO.1 1863 CDS 100% 4.950 3.465 N Calcoco1 n/a
6 TRCN0000184478 GCTGAATTACAAACGGTCCGA pLKO.1 1006 CDS 100% 0.660 0.462 N Calcoco1 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2565 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026192.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.