Transcript: Mouse NM_026208.2

Mus musculus RIKEN cDNA 1700019N19 gene (1700019N19Rik), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
1700019N19Rik (67507)
Length:
923
CDS:
17..730

Additional Resources:

NCBI RefSeq record:
NM_026208.2
NBCI Gene record:
1700019N19Rik (67507)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026208.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196002 CAGCAGGGATTAAACTGCTCT pLKO.1 197 CDS 100% 0.264 0.370 N 1700019N19Rik n/a
2 TRCN0000184704 CGCATGAATCCCTGTGTGAAA pLKO.1 140 CDS 100% 4.950 3.960 N 1700019N19Rik n/a
3 TRCN0000196091 GCACAGACACCTGTTGTACTT pLKO.1 770 3UTR 100% 4.950 3.465 N 1700019N19Rik n/a
4 TRCN0000184749 CACCATCCTTAGCAAAGGCTT pLKO.1 696 CDS 100% 2.640 1.848 N 1700019N19Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026208.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.