Transcript: Mouse NM_026255.5

Mus musculus solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 26 (Slc25a26), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Mus musculus (mouse)
Gene:
Slc25a26 (67582)
Length:
1933
CDS:
112..936

Additional Resources:

NCBI RefSeq record:
NM_026255.5
NBCI Gene record:
Slc25a26 (67582)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026255.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070044 CACGGACTCTACTTCACACTT pLKO.1 348 CDS 100% 4.950 3.960 N Slc25a26 n/a
2 TRCN0000317479 CACGGACTCTACTTCACACTT pLKO_005 348 CDS 100% 4.950 3.960 N Slc25a26 n/a
3 TRCN0000375327 CGTCTCAGTCCTCTCAATAAA pLKO_005 1078 3UTR 100% 15.000 10.500 N Slc25a26 n/a
4 TRCN0000070047 CTCTGTGGACTTGATATTATT pLKO.1 165 CDS 100% 15.000 10.500 N Slc25a26 n/a
5 TRCN0000349941 GGACTGTACCGAGGCTATAAA pLKO_005 526 CDS 100% 15.000 10.500 N Slc25a26 n/a
6 TRCN0000313967 TGCCTATTGTGTAAGATTATA pLKO_005 1276 3UTR 100% 15.000 10.500 N Slc25a26 n/a
7 TRCN0000313903 ACAGGGACTAGCCGGGTTATT pLKO_005 804 CDS 100% 13.200 9.240 N Slc25a26 n/a
8 TRCN0000070045 TGGTGGATTTCGTGGGATATA pLKO.1 240 CDS 100% 13.200 9.240 N Slc25a26 n/a
9 TRCN0000070043 CGTGGCTAAGACAAGGATCAT pLKO.1 714 CDS 100% 4.950 3.465 N Slc25a26 n/a
10 TRCN0000070046 GTTTCCCTTGTGGGAATCCTT pLKO.1 585 CDS 100% 0.300 0.210 N Slc25a26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026255.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.