Transcript: Mouse NM_026256.2

Mus musculus POTE ankyrin domain family, member G (Poteg), transcript variant 1, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Poteg (70952)
Length:
1440
CDS:
149..1192

Additional Resources:

NCBI RefSeq record:
NM_026256.2
NBCI Gene record:
Poteg (70952)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026256.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103814 ACACCTTGATATACGCTATAA pLKO.1 792 CDS 100% 13.200 18.480 N Poteg n/a
2 TRCN0000103811 GCTTCAGTACAACGCTGATAT pLKO.1 646 CDS 100% 13.200 18.480 N Poteg n/a
3 TRCN0000103812 CGCTATAAGATGTGGATCAAA pLKO.1 805 CDS 100% 5.625 7.875 N Poteg n/a
4 TRCN0000103810 CAATTTGGTAAGCAATCAGAA pLKO.1 1278 3UTR 100% 4.950 3.465 N Poteg n/a
5 TRCN0000103813 CCATACAACATACAGACCGTT pLKO.1 271 CDS 100% 2.640 1.848 N Poteg n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026256.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.